Where do I come from?

Forward to Starting out  –  Back to Foreword
Back to Writing

The Genographic Project

Delving into my family history has taken me back a thousand years but there is another far deeper approach. Our DNA can trace us back to a series of major migrations out of Africa commencing around 400,000 years ago. My genes had been busy evolving deep within my antecedents and culminated in me – you may ask was it worth all that effort? I provided my DNA and $99 to find out more from The Genographic Project (via National Geographic).

Regional origins

At first, their findings didn’t seem particularly exciting as the chart below shows I am clearly European. But stick with it because it does get more interesting.

Even this chart proves deceptively simple. When the UK average is shown beside it, this indicates that my %ages for Scandinavia and Southern Europe are significantly higher than the UK norm.

One half of my twenty-three chromosomes came from my father and the other half from my mother. These are said by nativist psychologists to predetermine or predispose certain of our features and characteristics, including attributes evident at birth such as eye, hair and skin colour. Not that ‘at birth’ was very informative for me as I was blonde and blue eyed for my first few years, both turning brown later. The hair of course settled for grey later still.

A very young me

Our genes also determine our vulnerability to events such as hair loss, certain diseases and our life expectancy – not that this stops the pharmaceutical companies endeavouring to tinker with these. Nativists ponder how far this genetic inheritance extends in shaping our intellect and mental capacities, perhaps colouring our opinions, attitudes and approaches to life. Rather unsatisfactorily they appear to conclude simplistically that the earlier a trait appears during our development then the more likely it is to have been from our genes.

Of course our attributes are also heavily shaped and determined by our nurturing. Certainly our first three years is generated by our parents. They also play a significant role through the twelve to fifteen years while most of us live at home battling through our education.

So parenting passes on the genetic markers deep within us and then plays a major role in our nurturing. This fifteen years of the 70-year promised lifespan equates to over 20% of our life, making our parents’ role highly significant.

Neanderthal tendencies?

The Genographic Project’s first test was to see how much Neanderthal I had in my genes.

Homo heidelbergensis

Current theories suggest that we derive from Homo heidelbergensis, a species first discovered in 1907 near Heidelberg, Germany, hence the name. This species emerged in Africa and undertook an early migration out of Africa, between 400,000 and 300,000 years ago.

The group migrated north-west out of the continent, at some later stage splitting into two groups. Those who migrated west into Europe became known as Neanderthals and those who turned eastward evolved into Denisovans.

Distribution of the three early hominids

They are termed Neanderthal merely because their first remains were discovered in the Neander valley, near Dusseldorf in Germany. Denisovans were first discoved in the Denisova cave in Siberia. They were found in the 1970s but the significance was not properly understood until 2008. Both groups have been long extinct.

The stay-at-home Africans, Homo heidelbergensis, later evolved into a new species, Homo sapiens sapiens. Of slender build and bipedal, with an average brain size of 1350cc, homo sapiens sapiens had a rising forehead, very small eyebrow-ridges and a prominent chin – essentially much the same as we are today – and this species represents the only hominid existing today – us!

A number of haplotype mutations have been shown to have taken place within Africa before the next major northward migration. The ice in northern Europe had begun to melt and recede. As Africa became warmer and moister, areas of the Sahara became both passable and habitable. The animals habitually hunted by our ancestors roamed further north and we followed them. These hunters represented the first modern humans to leave Africa. All of us found outside Africa today derive from these groups. They left the continent between 70,000 and 60,000 years ago.

Homo sapien, Neanderthal and Denisovan skulls compared

This next wave of modern humans would later of course have encountered those earlier migrants, the Neanderthals and Denisovans, on their travels. Neanderthals became extinct between 41,000 and 39,000 years ago. Denisovans are thought to have survived, in New Guinea, until 14,500 years ago.

Distribution of Neanderthals

Around the same time as these earlier hominids were becoming extinct some 40,000 years ago there was another climate change. Drought turned North Africa and the Middle East back into desert, effectively ‘slamming the door’ behind those modern northern migrants for 20,000 years. So my ancestors, maternal and paternal, had set off and could not return to Africa, thus promoting a continuing migration north, east and west.

Hominid family tree

There is evidence there was ancestral interbreeding with the Neanderthals and Denisovans before their extinction. Most Europeans and Asians carry a memento of these (much maligned!) hominins; between 1% and 4% of their DNA is Neanderthal. Melanesians have between 3 and 5% Denisovan genes.

Percentage Neanderthal of me v Genographic Project average

I’m not sure I should feel joy but I should mention my contentment that I prove to be down at the bottom end of that scale, my DNA being just 1.2% Neanderthal. I am also low compared with the Genographic Project’s current average of 2.1%. Perhaps it was just that my antecedents were late-arrivals or not very good at meeting the neighbours?

Modern human replacement of Neanderthals in Europe – Upper Paleolithic c. 40,000 BP

My haplogroups have been tested by the Genographic Project and they suggest I am R-Z8 (paternal) and K2A (maternal) – more below. Of all those (some 740,000+) who have submitted material to the Genographic Project I appear to be relatively unusual in that my paternal RZ-8 haplogroup is shared with only 2.8% (1 in 36) of the participants and my maternal K2A with just 0.3% (1 in 333). Nice to feel special, but let’s look a little deeper.

The science bit

You can safely skip this if it doesn’t interest you.

The USA National Library of Medicine provides this good illustration and offers a clear definition of DNA:

DNA, or deoxyribonucleic (de-oxy-ribo-nucleic) acid, is the hereditary material in humans and almost all other organisms. Nearly every cell in a person’s body has the same DNA. Most DNA is located in the cell nucleus (where it is called nuclear DNA), but a small amount of DNA can also be found in the mitochondria (where it is called mitochondrial DNA or mtDNA). Mitochondria are structures within cells that convert the energy from food into a form that cells can use.

The information in DNA is stored as a code made up of four chemical bases: adenine (A), guanine (G), cytosine (C), and thymine (T). Human DNA consists of about 3 billion bases, and more than 99 percent of those bases are the same in all people. The order, or sequence, of these bases determines the information available for building and maintaining an organism, similar to the way in which letters of the alphabet appear in a certain order to form words and sentences. DNA bases pair up with each other, A with T and C with G, to form units called base pairs.

The National Genome Research Institute described the process further:

The sequence of bases in a portion of a DNA molecule, called a gene, carries the instructions needed to assemble a protein. These A, C, G, and Ts are strung together in a way that the cellular machinery, the ribosome, can read them and turn them into a protein. In the genetic code, each three nucleotides in a row count as a triplet and code for a single amino acid. […] proteins are made up of sometimes hundreds amino acids, so the code that would make one protein could have hundreds, sometimes even thousands, of triplets contained in it.

Our personal DNA is created by a combination of two half-sets made up from our parents’ DNA. These half-sets are called haplotypes. We combine one inherited haplotype from our father and one from our mother.

A haplotype is a group of alleles in an organism that are inherited together from a single parent.

An allele is each of two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome.

A haplogroup (haploid derived from the Greek haploûs, meaning ‘onefold, simple’ and the English group) is a group of similar haplotypes that share a common ancestor with a SNMP or single-nucleotide polymorphism mutation. it is possible to predict a haplogroup from haplotypes. Haplogroups reference a single line of descent.

Our chromosomes, Source: flikr.com

The Y-chromosome is passed on unchanged from father to son, and the mitochondrial DNA (mtDNA) is passed on by mothers to each child, though only female offspring pass it on.

Mitochondrial structure

The majority of a human’s DNA is contained in the chromosomes in the nucleus of the cell, the mtDNA is an exception.

Mitochondria are small organelles that lie in the cytoplasm of cells, such as those of humans. Cytoplasm is the solution that fills each cell, enclosed within the cell membrane, it consists of water, salts, and proteins. Their primary function is to provide energy to the cell.

Mitochondria are thought to be reduced descendants of symbiotic bacteria that were once free living.This latter is prompted by the fact that its ring-like structure is similar to bacteria.

DNA tracking

The mutations that cause new haplotypes and haplogroups are calculated to happen around every 3,500 years in the mitochondria and a little more frequently in the Y-chromosome.

It is on these estimated intervals that many of the dates that follow in this piece are based, so they are subject to change and represent our best guestimates for now. In recent times the dates appear to be more often pushed backwards in time.

Two forms of testing are normally used, Y-STR (short tandem repeat) and Y-SNP (single nucleotide polymorphism). Y-STR is more often used in forensics, while Y-SNP is used to discover deep ancestry.

These genetic changes are faithfully retained in the genes and show the divergence caused by the mutation. It is however by looking at a series of closely-linked SNPs that gives confidence in this sort of genetic tracing.

Tracing Y-Chromosome to its various deriveed haplogroups, A – R

My paternal DNA derives from R1b. The Y Chromosome Haplotype Reference Database (YHRD) is an open-access database maintained by ‘ Legal Medicine and Forensic Sciences’ and ‘Charité – Universitätsmedizin Berlin’ since 1999. It started with a single haplotype, and two decades on, at the end of 2019, it lists 307,169 haplotypes. This is clearly fast-changing, doubling in number from Jul-2015  to Dec-2019.

Y-chromosome Adam

Investigating these Y-chromosomes reveals that my first traceable ancestor, and yours, goes back a very long way. Between 300,000 and 150,000 years ago the common paternal ancestor of all of today’s men was born in Africa. Of course he was not the only male of his time, it is merely that his lineage and his Y-chromosome was the only one that survived (human bottlenecks, natural disasters and climate changes), he was the only one to pass down his DNA to all humans today – he was the first alpha-male.

Of course the popular press promptly heralded him as the Y-chromosome Adam. This Adam was defined as bearing the A00 haplotype – a version only found only in African populations. Yes, we are all descended from Africans!

The shorthand of my paternal track is P305 (A1) – M42 (BT) – M168 (CT) – P143 (CF) – M89 (F) – M578 (HIJK) – P128 – M526 (K2)- M45 (P1) – M207 (R) – P231 – M343 (R1b) – M269 – P310 (R-L52) – U106 (see more below).

My Paleolithic paternal lineage track – follow this from A to B, to 168, CF, F, IJK, K, M526, P, R

Note: that second haplotype M42 signifies a variation or polymorphism in the DNA. In fact it changed two nucleotides, with adenine beccoming thymine in the sequence – so that aaagcgagagattcaatccag became ttttagcaagttaagtcaccagc.

Haplogroup I primates all have an A hapolotype at the same location as M42. This M42-A allele indicates this is a descendant of Y-Adam. But at some point one of his descendants had this T mutation and therefore is references as M42-T. The really significant issue about this polymorphism was that to-date all M42-As identified have remained in Africa whereas the M42-Ts migrated out of Africa.

This map suggests how my track might have progressed in the Mesolithic and Neolithis periods.The A plots are not necessarily valid for my track, instead start at BT-M42 because from there it mirrors my early track.

My test shows successive mutations M343-M269, and makes no reference to R-L754/R-L389 or R-P297. Should I assume that this means my antecedents took a route north around the Caspian Sea? But then other maps, I have found, show M343/R1b as definitely passing beneath and west of the Caspian. If so, then why did my DNA test not detect those three other haplogroups shown here up the western shores of the Caspian?

Does this chart suggest that R-L21, R-L51 and R-L151 should become part of my journey too? And, those Z haplotypes that head toward the UK and into the Bronze and Iron Ages, are they potentially in mine too? The whole topic is still moving and this exercise done in the future may draw other conclusions.

Seven miles per year!

So, by following the haplogroups that are in my DNA, I can posit that my antecedents appear to have travelled from Cameroon to Chad and on to the Central African Republic, the Democratic Republic of Congo, South Sudan, Uganda, Ethiopia, Djibouti, Yemen, Oman, the UAE, Saudi Arabia, Kuwait, Iraq, Iran, Afghanistan, Tajikistan, Kyrgyzstan, China, Mongolia, Kazakhistan. Uzbekistan, Turkmenistan, Russia, Ukraine, Moldova, Romania, Hungary, Austria, Germany, Benelux. That’s thirty one modern countries crossed on foot, a journey that can only be estimated at some 22,500 kms (or 14,000 miles), but then, they did take over 100,000 years to do it – that’s just seven miles per year!

The above simple chart of major haplogroups includes some of my paternal haplogroups (M168 – M89 – [M9] – M45 – M207 – R) and provides a date for each (kya = 1,000 years ago). Source: Smolenyak and Turner, 2004; Wells, 2007; ISOGG, isogg.org/tree/index.html

Note: Be aware that the letters in haplotypes were allocated as they were found and do not imply any sort of chronological significance. Somewhat confusingly both Y and mt haplogroups use the same set of letters. Though The Haplotype Reference Consortium (HRC) does try to regulate usage and integrate various originators.

In the meantime female evolution can be tracked through the mitochondria, located in a circular molecule with its own genome sequence of thirty-seven genes (not the Y-chromosome’s 46). Down the years mitochondria have mutated and tracking major haplotypes allows geneticists to categorise them.

Haplogroups represent the major branch points on the mitochondrial phylogenetic tree. Understanding the evolutionary path of the female lineage has helped trace the matrilineal inheritance of modern humans all the way back to human origins in Africa and the subsequent migrations around the Earth.

This mitochondria investigation has implied that all current living human beings derive from an individual woman, inevitably referred to as the Mitochondrial Eve or mt-MRCA (Mitrochondial Most Common Recent Ancestor) She lived around 180,000 years ago in East Africa, her mitochondrial DNA is designated as LO. She passed on the L haplotype shared by every woman in the world today. It was the L3 variant that left Africa and the chart above shows the migrations around the world.

It has been established that women move more often than men. Of course hunter-gatherers travel more than their familial females, but females move to live with their ‘husband’ and thus have spread their genes more widely.

The shorthand of my maternal track is LO – L3 – N – R – U – K – K2 – K2a  (more below).

Migrations

Tracking the mutations present in my DNA, as revealedby the Genographic Project, suggests the route that my parental antecedents must have taken. Once again the surprise is quite how far afield we Dentons wandered.

My maternal line is K2a and can be traced from those who left Africa to became Early Neolithic farmers (ENFs) in Anatolia and the Near East, and later became Early European farmers (EEFs). These groups are believed to have split off from the Western Hunter Gatherers (WHGs) at around 45,000 BP, and to have split from Caucasian Hunter Gatherers around 25,000 BP. The essential difference is that the EEFs had significantly more WHG ancestry than did the ENFs.

My paternal DNA is specified ultimately as R-Z346 or R-Z8, both are part of the R1b series, which is said to have originated and been spread by the Celts as they migrated into Western Europe during the Bronze Age.

R1b has been detected in the UK, Ireland, Brittany, Asturias, Galicia and northern Portugal. Off the north coast of Ireland, on Rathlin island, three burials of early Bronze Age men (2000-1500 BCE) were found to have R1b ancestry.

However R1b has also been found in Bahrain, Bhutan, western China and Turkey. It has also been found in the persecuted Bashkir community of Russia, who lived in a region between the Volga river and the Ural Mountains. They lived in Badzhgard, where Northern Asia and Eastern Europe meet, and were culturally Iranian and Turkic.

The earliest R1b find was in the Cismon Valley near Veneto, Italy dating from 14,000 BP.

Spread of agricultural settlements 8,000 – 6,000 BP

The four maps above show how the practice of agriculture spread through Europe, this went hand-in-hand with the spread of R1b,

Dating from 10,000 – 8,500 BP, there have been many R1b finds in the central Danube area (today’s Romania and Serbia) near Iron Gates.  Two indiviudals of the Narva Culture (today’s Baltic countries, Belarus, Poland, Russia), dating to 7,800-6,800 BP, were found with R1b. A further find from 7,500 BP was of an R1b Samara hunter-gatherer, living near the Samara bend of the Volga river. Another R1b individual was found in today’s Kazakhstan, a member of the Botai culture and dating from 5,500 BP.

Spread of Proto Indo European languages

The purple area on the map above is the site of the Samara culture, said by some to be the origin of the Proto Indo Europeans, and their languages, who went on to populate much of Europe. In doing so they supplanted the Neanderthals already in the continent. But this is just one step along the migration of my paternal line.

But we are getting ahead of the tale. All modern humans emerged from the Rift Valley that stretches from the Beqaa Valley in Lebanon to Mozambique.

The Y-chromosomal ‘Adam’ lived between 300,000 and 160,000 years ago. He is more scientifically termed as the MRCA, or ‘most recent common ancestor’, he is patrlineally linked to all current human males. He is certainly not any sort of biblical Adam, many other humanoids would have lived with and around him. It is just a matter of kismet that his lineage survived and others did not.

What is strange about Y-Adam is that he is said to have come not from the east of Africa but from the north-west. His haplogroup is present among the Mbo people of western coast of present-day Cameroon. Y-Adam arrived much later than mt-Eve and so is certain to have descended from her.

Cautionary note: Do be aware that Y-Adam and mt-Eve are merely our patrilineal and matrilineal most recent common ancestors of the species homo sapiens. With apologies to creationists, they were of course predated by antecedents and lived with many others of their species.

Y-Adam is still referenced with a very broad origin range, 300,000-160,000 years ago, indicating that the ‘court is still out’ on him. He is most often suggested as living along the coast of modern Cameroon, not East Africa.

The Mitochondrial-Eve (mt-Eve) is dated to 230,000- 100,000 years ago, which suggests that they did not live at the same time. And, certainly, they did not live in the same place, he in Cameroon, she in the Rift Valley, thus some 3,000 kms apart. That’s as the crow flies, even by today’s roads it is twice that.

There are several nomenclature conventions to suggest that Y-Adam is A0000 (or A1b), the original Neanderthal is A000, the original Homo sapiens is A00. The use of the Y-chromosome and mitrochondria clearly shows that everyone shares the same SNPs as Africans, and to support the out-of-Africa migration, non-Africans do share other SNPs that the Africans do not.

Fake news: There have been theories that are today non-PC. In 1864 Karl Voght in his ‘Lectures on Man’ proposed that there were three branches to humankind, with gorillas evolving into Africans, orangutans into Asians and chimpanzees into Europeans.

Carleton S Coon, at some point president of the American Association of Physical Anthropologists, in his 1954 ‘The Story of Man’ and his 1962 ‘The Origin of the Races’ proposed a ‘Candelabra Hypothesis’. This suggested four or five candelabra-arms depicting races of humans evolving separately in Australasia, the Caucusus, Mongolia and two in Africa. But then he was also a believer in bipedal ‘cyptids’, extant descendants of ancient apes, which he believed explained Sasquatch and Yeti sightings.

Y-Adam had two male descendant routes – AO (L991) and A1 (L985 and P305) . From A1 there were three descendant types, A1a (P108), A1b (P108), From A1b derived A1b1, who remained in Africa, and BT (M91/M42), which originated in north-east Africa and would later leave Africa.

P-305

The traceable part of my paternal story starts here, probably 160,000 to 100,000 years ago in East Africa, when my first mutated marker occured, P305 (alternatively referenced as A1, A-P305, A-V148 or A-CTS2809/L991). This is one of the oldest known mutations that is not shared by all men. Therefore, it marks one of the earliest splits in the human Y-chromosome tree, and modern human evolution. The man who first carried this mutation lived in Africa and is the ancestor to more than 99.9% of paternal lineages today. In fact, men who do not carry this mutation are so rare that its importance in human history was discovered only in the past few years.

As P305-bearing populations migrated around the globe, they picked up additional markers on their Y chromosomes. Today, there are no known P305-bearing individuals without additional markers. When these P305 carriers left East Africa, some headed south to today’s South Africa and have been detected among, for example, the San people of Namibia.

Modern San people from Namibia

There was an earlier migration out of Africa around 100,000 years ago, with evidence in Israeli caves that show the Heanderthals already there did receive visitors from the south. But this is considered as a false-start

M42

Other P305s, like my ancestors moved into the Rift Valley and then moved on northward into today’s South Sudan. Around 80,000-60,000 years ago, the BT branch of the Y-chromosome tree was born, which is defined by many genetic markers, including M42. The M42 marker identifies the common ancestor of most men living today, some of this man’s descendants would begin the journey out of Africa to the Middle East and India. Some small groups from this line would eventually reach the Americas, while other groups would settle in Europe.

Some M42s would however remain near their ancestral homeland in Africa as traditional hunter-gatherers in the eastern Congo, the Mbuti pygmies who live in the Itun tropical rainforest (just 30-40,000 remain), the western Congo BiAaka pygmies (also around 30,000 remain) and the north-central Tanzanian Hadza who live around Lake Eyasi in the central Rift Valley and Serengeti (only 1,000 remain).

Mbuti people pictured in 1930
M168

The next mutation on my paternal side was the M168 (or CT) marker occurring around 70,000 years ago in north-east Africa; these ancestors probably lived in Ethiopia, Kenya or Tanzania. The M168 branch was one of the first to leave the African homeland and is present in every non-African man living today. (Conversely it is B-M60s that are exclusively found in Africa today.)

This M168 mutation occurred around the time there was a leap in human intellectual capacity that led us to develop tools and weapons and evolve language. Many scientists believe that the emergence of language, at this stage, besowed a huge advantage over other early humanlike species. Improved tools and weapons, an ability to plan ahead led to new group hunting techniques, art also made an appearance around this time. Perhaps this increased capacity prompted modern humans to migrate to new territories, exploit new resources, and in doing so replaced other hominids such as the Neanderthals.

Writer’s note: Is this leap in intellectual development (c.70,000 BP) and the need to survive Mount Toba’s climate changes (c.73,000 BP) a coincidence of events or did our brains become better to survive? Necessity became the mother of intellectual growth?

The Haplogroup CT-M168, in popularised accounts, has been referenced as the ‘Eurasian Adam‘ or ‘Out of Africa Adam’.

M168 carriers certainly migrated eastward and out of Africa. This was nothing like the scenes of epic movies of the 1950 and 1960s. Researchers suggest that it was only some ten thousand people that actually migrated, and that this happened across a long period, from 100,000 to 50,000 years ago. It is surmised that their food source had ‘moved’ and so they followed it. Was it that stocks were being exhausted or some climatic change prompted the move?

CT-M168 has only two major subclades. CF (‘mine’) and DE (mostly found in Asia/Africa).

One possible explanation is the super-volcanic eruption of Mount Toba in Sumatra, that occured around 73,000 BP. It sent ash and gas 30 miles (50 kms) into the atmosphere and shrouded the entire planet, it cooled areas of the Earth until 60,000 BP, and still had impact across the next 25,000 years with swings in temperature from those like today’s to the Ice Age at its worst. These cold snaps are called ‘Heinrich Events’ and occured in five of the last seven ice ages.

A National Geographic report graphic, illustrating the relative strengths of volcanic eruptions in history

Mount Toba’s is considered the largest explosion to have occured on the Earth (see graphic above). Unsurprisingly it is said to have had profound climactic impact, potentially interfering with vegetation in the region and disrupting food sources.

Some experts propose this prompted a ‘human bottleneck’. This assumption based upon a lack of genetic differences detected around this period. Some suggest this eruption left only 10,000 humans alive, one report I found said just 2,000 survived. These would have been those that had moved east out of the Rift Valley and into the Arabian peninsula. M168 carriers were thus fortunate survivors of Toba. Of course, there are those who dispute this theory, but this did coincide with our ancestors leaving Africa.

With these disruptive weather conditions to the south and the Mediterrnean to the west, they would have had little choice but to move east and north.

mt-L3

Mitochondrial Eve’s female descendants experienced genetic mutations that established two new distinct lineages designated as LO and the other rather inelegantly named L1’2’3’4’5’6 group. Both these descendant groups are found only in Africa.

A further mutation led to the creation of the L3 haplogroup 72,000 years ago in East Africa. One individual would have had a mutation to her mitochondrial DNA, which she then passed onto her children. The children proved successful, and their descendants ultimately broke away from L1’2’3’4’5’6 group, to create this new L3 group.

Many with L3 lineage in fact remained in Africa and proved predominant in the Bantu-speaking groups of west-central Africa along the Niger-Congo. There are some 650 Bantu languages and dialects here. L3s also dispersed south via today’s Mali to South Africa. Only an insignificant quantity of those outside Africa do not carry L3.

My maternal L3 haplotype group was specifically present in all the northern migrations that led out of Africa, but my line left Africa by a different route, travelling further north up the Nile or by crossing the Red Sea.

Much. much later there would be further enforced L3 migrations from Africa, this time due to the Atlantic slave trade from West Africa to the Americas and Caribbean. For this reason L3 is present in many African-Americans too.

My rough plot of the mutation markers to describe the routes of my maternal antecedents (mauve) and paternal antecedents (blue) taken from Africa to Europe. The codes are the haplotypes, the numbers are the approximate number of years ago (BP – Before Present) that they would have been in that area.
P143

My paternal ancestors migrated from the Horn of Africa crossing the 30kms (20-mile) strait (at the junction of the Red Sea and the Gulf of Aden) from today’s Djibouti and Eritrea into a fertile Yemen. Named the Bab-al Mandeb strait, it means ‘Gate of Tears’ or ‘Gates of Grief’ derived from an Arab legend of the many who died when an earthquake separated Ethiopia and Arabia. Today almost 10% of the oil moved by tankers passes through this strait.

I find it intriguing that my father spent time in Eritrea during WWII as a member of RAF ground crew he could not bear the insect life. He would soak his bed and bedding in petrol, then stand all four legs of the bed in trays of pungent liquid. He still couldn’t sleep, so spent much of the day sleeping inside the airframe he was supposed to be repairing/maintaining. He had absolutely no idea that in being there he was following in the footsteps of his antecedents.

My paternal lineage then had a further mutation to create the P143 (or CF) paternal haplogroup at around 60,000 years ago. This was the first mutation recorded to have occured outside Africa, if only just outside, in the Jeddah, Mecca and Medina region of today’s Saudi Arabia. Yet this was a pivotal moment in the evolution of modern humans.

The first migrants probably ventured across the Bab-al Mandeb strait, a narrow body of water at the southern end of the Red Sea, crossing into the Arabian Peninsula. It would have been soon after this that mutation P143 would have emerged. These ‘beachcombers’ made their way along the coast to India and on into Southeast Asia.

M89

Around 55,000 years ago (the estimates range from 43,800-62,500) the M89 (or F or FT) paternal mutation occurred in the Middle East. This mutation and its derivatives are present in 90% of all non-African males – perhaps another bottle-neck moment? In its basal form M89 is mostly present today in India. From here it spread through South and Southeast Asia and into neighbouring parts of the Middle East.

One hypothesis has some descendants with M89 going back into Africa. More certainly, for some thousands of years this M89 population apperaed content to live by following the movements of herds of wild game around the region.

It was only when the land started to become dry that they travelled northward through today’s Iran to the Caucasus and the Eurasian steppe of Central Asia. These semiarid, grass-covered plains would eventually form an ancient “superhighway” stretching from France to Korea. A smaller group continued moving north from the Middle East to Anatolia and the Balkans, trading familiar grasslands for forests and high country.

However the ISOGG ( International society of Genetic Genealogy) declares that little study has been applied to this period – as yet.

M578

At around this time M89 split into two subclades, with my lineage taking the branch with the M578 paternal marker (or HIJK). This originated near the present-day Iraq-Saudi border, around 50,000 years ago . One group of these M578s set off eastward populating India and Southeast Asia and eventually reaching Australia; these were the ancestors of some of today’s Australian Aborigines.

Those that stayed in the Middle East found, bout 40,000 years ago, the climate shifted once more, it became arid and colder. Drought hit Africa and the Middle East and the grasslands reverted to desert, and for the next 20,000 years, the Saharan Gateway was effectively closed. With the desert impassable, staying in the Middle East becoming an issue, return to Africa, the home continent, no longer an option – they migrated north, through Anatolia to the Balkans. My paternal ancestor is shown to have pressed on north towards the Black and the Caspian Seas.

NOTE OF CAUTION – switching to maternal lineage here, please don’t confuse the same letters that are used in both paternal and maternal lines. For example K2 for males is haplogroup M526 dated to around 45,000 years ago, while female mitochondrial K2 is dated much later from 21,000 years ago among early farmers.

mt-N

My L3 maternal ancestors became the source of northern migrants when further mutations were generated around 65,000 years ago and formed new maternal haplogroups, M and N, which would maternally populate the rest of the world outside Africa.

L3 carriers had lived in the Rift Valley for some 100,000 years but as the European ice age retreated they were drawn north to exploit a warmer and moister climate to the west of the Ethiopian Highlands. From here the migrants travelled, up the Blue Nile valley and on to the White Nile. It is suggested that they fabricated simple log boats to travel north up the Nile towards the Levant. Alternatively members of this group followed the shores of the Red Sea and crossed by boat into the Sinai Peninsula – leaving Africa for Asia.

Both parental Red Sea crossings would have been heped by glaciation that meant the sea was 300 ft (90 m) lower than it is today. Making crossings by log boat more straightforward. The draw to cross was that the climate of the time meant that the Arabian peninsula was fertile.

Once in Asia the L3 people met and mingled with the Neanderthals and with M9 and M45 groups. Caves in Israel have been found to hold modern humans living beside Neanderhtals some 60,000 years ago. This was the first comingling that passed the genes of Neanderthals on down our generations.

My maternal lineage was the N haplogroup that originated 60,000 years ago around today’s Duba and Tabuk in Saudi Arabia. Early members of this group settled in the eastern Mediterranean region and western Asia. Here, they are likely to have coexisted for a time with other hominids such as Neanderthals. Excavations in Israel’s Kebara Cave (Mount Carmel) unearthed Neanderthal skeletons as recent as 60,000 years old, indicating that there was geographic and temporal overlap of the two hominids. This accounts, in some part, for the presence of Neanderthal DNA in people living outside of Africa.

After a few thousand years settled in the Levant these ancestors once more pursued migration due to changing climates. Some migrated westward through present-day Turkey and the eastern Mediterranean, others went eastward through central Asia to be discovered in the Indus Valley of Pakistan and India.

Around 60,000 years ago my maternal antecedents spread north, most likely they followed the Nile basin, given its reliable water and food supply and thus avoiding the surrounding desert and its sandstorms. They crossed the Sinai Peninsula in today’s Egypt to reach today’s Jordan, Syria, Iraq and Iran.

Other N groups headed north from the Levant, hunters pursuing game, they crossed the Caucasus Mountains into southeastern Europe and the Balkans. Importantly, descendants of these people eventually went on to populate the rest of Europe, and comprise the most frequent mitochondrial lineages found there today.

mt-R

My maternal line had instead travelled up towards today’s Tabriz in north-west Iran where the next mutation happened some 55,000 years ago, the maternal haplogroup R.

Haplogroup mt-R proves complex because its origin is quite ancient, individuals can therefore be found almost everywhere. The N and R genetic lines are much entangled, both are found in many of the same remote places. Thus, geneticists are still working to unravel the different stories of haplogroups N and R.

However, it is assumed that across this period there was a lightening of the skin, from African black to Middle East olive-green. A process of natural selection opting for this lighter colour as more functional in the less humid and lower UV conditions.

mt-U

The next maternal mutation occurred some 47,000 years ago to create the U haplotype. These were my mother’s antecedents who continued northwards past the Caspian Sea to its west and through today’s Armenia, Azerbaijan and Georgia. They then turned westward passing above the Black Sea and onto the steppes of today’s southern Russia. They lived in and around the present-day Baltic States and western Eurasia, where the grasslands became a stable base for subsequent migrations north and west.

The U lineage, today, is present in populations of Europe, West Asia (including Arabia), North Africa, India, and the North Caucasus Mountains.

In Europe, this lineage averages 7 percent of the population. In Scandinavian countries it is 9-16% of the population. In England, it is about 12% of the population. It is present in 10-12% of the populations of Croatia and Greece.

P128

The next paternal mutation, the P128 (or P-M128) haplogroup, occured over 45,000 years ago and occured north of today’s Kabul on the Afghanistan-Tajikistan border. Half of all non-Africans derive from this lineage.

The P128 haplotype then split three ways – into the O group that is most commonly found in East Asia as a second wave of easterly migrants, the Q group that is the major lineage in the Americas, and ‘my’ R group, the major lineage that would populate Europe and Central Asia.

From 45,000 to 40,000 years ago the climate began to change bringing both colder and yet more arid conditions to the Middle East. The grasslands suffered so that the wild game and the human populations moved on.

M526

My paternal lineage appears to have added the M526 (or K2) mutation as it continued eastward on what sounds like an arduous route, over the Zagros mountains into modern Iran, then on through the Hindu Kush (Afghanistan/Pakistan), through the Pamirs and the Tien Shan (or Celestial Mountains) emerging in western China some 42,000 years ago. So my parental lineage were early travellers upon the southern Silk Road – though this would start forty centuries later!

The Silk Road
M45

Some 35,000 years ago the M45 (or P1 [combined with PF5962] or K2b2a) mutation saw my paternal lineage moving in small big-game hunting groups onto the open savannah, travelling north-west across Kyrgyzstan and Kazakhstan. M45 has two subclades Q and R (‘mine’).

Two M45 individuals, dated from 31,600 BP were found at a Paleolithic archaeological site near the Yana River is Sakha in NE Russia. Today M45/P1 proves common among inhabitants of Eastern Siberia and Central Asia. It is present in 35.4% of the Turkic-speaking Tuvinians and 28% of Altai-Kizhi peoples (both from East Siberia), and 35% of Nivkh people (along NE Russia’s Amur River and parts of Manchuria). These are minorities, there are 320,000 Tuvanians, 74,000 Altaians amd just 5,287 Nivkshs (as at 2002).

Nivkh people, pictured in 1902

M45 went on to create the O, Q and R groups (see above under P-128) that eventually populated the planet. One M45 descendant group is found mostly in India, the Saora from Andhra Pradesh, the Bhumji from Assam, West Bengal, Odisha and Jharkhand and Muslim groups in the far north-east of Manipur.

However M45/P1 has also been detected in both the Upper Paleolithic (Old Stone Age) Gravettians and the Mesolithic (between Upper Paleolithic and Neolithic) Magdalenians.

M207

Around 30,000 years ago the M207 paternal marker emerged as the stepping stone to several important groups, though none of them are in my lineage. M207 combined with M173 is the R haplogroup. R-M432 from which derive most western European men and those from the Americas and Central Asia. R-L62 which is common in eastern Europe and India.

Some suggest that Native American Indians have R-M 207, though this is not generally accepted, others suggest they are instead R-M242. One subclade R1b1a2 proved to be the most common haplogroup in Western Europe – and for some reason in Bashkiria, modern Russia, beside the Volga and Ural mountains. There was a paleolithic community here, swelled in the Bronze Age by a westward migration of the Abashevo culture, adept at fabricating bronze decorations, tools and weapons. This was where the first permanent settlements were established in the Urals.

Cave paintings, Shulgan_Tash in Baskkiria

My ancestors moved westward between 30,000 and 17,000 years ago. Strangely the Haplotype R is often shown to have a sequence, which ran R-M207, R1-M173 and R1b-M343. My sequence does not show that R1 middle haplotype, but instead shows P103. But then texts suggest the RI haplogroup data is quite vague, this was a period of maximum glacial spread.

mt-K

Meanwhile, the maternal K haplotype emerged from the U branch, some 27,000 years ago in today’s Ukraine near Mariupol. Her descendants include several different subgroups, some with very specific geographic homelands – specific European, northern African, and Indian communities, and it is found in Arabia, the northern Caucasus Mountains, and throughout the Near East.

Some members of this haplogroup headed north into Scandinavia and others went south into North Africa. But most members of the haplogroup K moved northward out of the Near East. These women crossed the rugged Caucasus Mountains in southern Russia, and moved on to the steppes of the Black Sea.

mt-K2

This was followed by the K2 marker 21,000 years ago.

mt-K2a

The K2a marker happened around 11,500-6,800 years ago at the time when PPNA (Pre-Pottery Neolithic A) groups were emerging, the very beginnings of the archaeological record. This mutation is said to have happened in west Asia at around 9100 BP (± 2,230).

K2a lineage is present in the United Arab Emirates (8 percent), Wales (5 percent), Northern Ireland (5 percent), Spain (3 percent), the Netherlands (1 to 2 percent), and France (1 to 2 percent). The Genographic Project warns that is branch is not accompanied by a major movement on the map, and research on this branch is continuing.

P231

Around 25,000 years ago, my paternal lineage ‘gained’ the P231 mutation, This was as they travelled across southern Russia and Belarus into Europe collecting further Y-markers as they went. Research is still ongoing and the next five markers in my male lineage present a confused picture.

Distribution of R1b today
M343

M343 emerged 22,000-17,000 years ago and is the oldest form of R1b. It is present in 7% of Russian males (including Tsar Nicholas II), 13% of males in the Balkans, 21% of Eastern Europeans, 43% of Central Europeans and 55-58% of Western Europeans.

The first M343 ‘members’ lived as hunter-gatherers on the open savannas that stretched all the way from Korea to Central Europe. They took part in the advances in hunting technology that allowed for population growth and expansions.

M343 was discovered to be present at two later archaeological sites Çayönü Tepesi, southeastern Turkey and in Dja’de el-Mughara, northern Iraq. Just 250 kms apart, the general area is considered as the haplogroup R1b ‘ground zero’.

Both locations have early signs of the domestication of cattle and the farming of emmer wheat. Çayönü also has signs it may have been the location where the domestication of pigs was first undertaken. Çayönü prospered from 10,600 to 8,800 BP.

M269

M269 between 15,000 and 6,500 years ago is present in 5% of males in Kazakhstan, 6-8% of those in Turkey, 13-14% of Greeks, 32% of Germans, 85% of the Welsh and 90% of east-coast Irish.

P310

My line’s next mutation was P310, which has the highest frequency of any male line in Western Europe. However, rather than a single movement across Europe, this lineage’s branches may represent many simultaneous and successive waves of migration. Today, it is found in 48-52% of male lineages in Ireland. It is 45% of those in France. It is about 38% of the male population in Spain. It is about 8% of male lineages in Italy, 5% of male lineages in Oman, 1-2% in Iraq, Lebanon and Kazakhstan.

U106

U106, from as early as 14,000 until 4,250 years ago, appears quite strong in Benelux, with 14% presence in the Netherlands, 13% in Luxembourg and 12% in Belgium. It is present in just 6-9% of the UK males, 4-5% in Cyprus and just 1-2% in Italy and Spain

L48

L48, Today, members of this lineage are present at low to moderate frequencies throughout Europe. To the south, they are present at trace frequencies of less than 1%. To the west and north, this line is between 1-2% of the population. Its highest frequencies are 7% of Belgian males, 4% of Netherlands, 3-4% in England, 3% in Denmark and Switzerland and 2-3% in Germany.

Mind the gap!

I don’t believe there is any way that I can seek to fill the gap I have between this DNA research (spanning 133,600 years ago to 2,500 BCE) to the current earliest date of my family history discoveries, that is Sims of Yetheram in 935CE.

So here ends the ancient part of my ‘accompt’. John Denton wrote his in Cumberland in 1603, mine is completed in Oxfordshire in the 2010s. If it turns out the next has the same interval I wonder where in ther year 2400 it will be prepared? In what format? And whether the author will still retain in some way our unusual family name – Robert Soulsby Denton?

Forward to Starting out  –  Back to Foreword
Back to Writing